CRISPRi-mediated knockdown of msmeg_6073 reveals condition-dependent growth and morphological phenotypes in Mycobacterium smegmatis

Authors

  • Ali Aadel Karimpour Medical Science program, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand
  • Suwatchareeporn Rotcheewaphan Division of Bacteriology, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand
  • Pornchai Kaewsapsak Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand

Keywords:

Mycobacterium smegmatis, msmeg_6073, RNA methylation, RNA modification

Abstract

Background: Tuberculosis remains a major global health challenge, highlighting the need for new therapeutic targets. Mycobacteria can adapt to environmental stress and antibiotic exposure through a potential mechanism called epitranscriptomic regulation, mainly RNA methylation.

Objectives: This study investigates msmeg_6073, the Mycobacterium smegmatis ortholog of the essential Mycobacterium tuberculosis gene rv3579c, predicted to encode a 23S rRNA 22 -O-methyltransferase involved in ribosomal RNA modification.

Methods: Using an anhydrotetracycline (ATc)-inducible CRISPR interference (CRISPRi) system, knockdown strains targeting msmeg_6073 were constructed. Among designed guide RNAs, guide 1 (5’ GGGAAGGCCGCGCCTGCGCACACCG 3’) showed the most consistent functional activity. RT-qPCR analysis confirmed transcriptional repression of msmeg_6073 under 50 ng/mL ATc induction conditions. Expression analysis of the upstream gene msmeg_6074 (cysS) was also conducted to evaluate target specificity. Phenotypic analysis included ATc-inducible drop assays and liquid culture growth curve analysis.

Results: RT-qPCR analysis confirmed effective transcriptional repression of msmeg_6073 under induced conditions. Furthermore, expression analysis of msmeg_6074 (cysS) showed no significant transcriptional changes, indicating targetspecific repression without upstream gene effects. Phenotypic analysis showed growth inhibition on solid media following msmeg_6073 repression, whereas no significant growth defects were observed in liquid culture. These findings suggest that msmeg_6073 repression may be condition dependent.

Conclusion: This study provides a validated CRISPRi workflow for inducible repression of msmeg_6073 in M. smegmatis. Future RNA methylation and MIC analyses may help clarify the role of msmeg_6073 in ribosome-associated processes and susceptibility to ribosome-targeting antibiotics, improving understanding of the mycobacterial epitranscriptome and its potential relevance to future therapeutic strategies.

Downloads

Published

2026-07-02

Issue

Section

Original article