https://he01.tci-thaijo.org/index.php/clmb/issue/feedJournal of Medical Bioscience2026-07-02T16:30:45+07:00Professor Sittisak Honsawek / Editor-in-Chiefchulamedj@chula.mdOpen Journal Systems<p>Former Title: Chulalongkorn Medical Bulletin</p> <p>ISSN: 2773-9996 (Print)<br />ISSN: 2774-0293 (Online)<br />Editor-in-Chief: Professor Sittisak Honsawek</p> <p> </p> <p>Journal of Medical Bioscience (JMBS) published by Office of Research Affairs, Faculty of Medicine, Chulalongkorn University with high quality scientific articles.</p> <p>JMBS is a multidisciplinary, open access, double-blind peer-reviewed international medical journal (in Thai or English languages) that publishes original research articles, review articles, case reports, and clinical studies including a broad spectrum of subjects in biomedical sciences and technology. JMBS has no submission and publication fees. All manuscripts are subjected to review by at least two independent reviewers.</p> <p>The aim of the JMBS is to publish scientific and technical research papers, to bring attention to the importance of technology in the field of biomedical sciences.</p> <p>All manuscripts submitted to JMBS are first assessed on the basis of scientific quality, originality, appropriateness, contribution to the field, and style. Applicable manuscripts are then subject to rigorous, fair, and rapid peer review.</p> <p>Issues per year: Semiannually (5 - 8 articles per issue)<br />No.1 January - June<br />No.2 July - December</p> <p> </p> <h2><a href="https://www.tci-thaijo.org/index.php/clmb/issue/view/15082/">Online First</a></h2>https://he01.tci-thaijo.org/index.php/clmb/article/view/290006CRISPRi-mediated knockdown of msmeg_6073 reveals condition-dependent growth and morphological phenotypes in Mycobacterium smegmatis 2026-07-02T16:25:45+07:00Ali Aadel Karimpourchulamedj@chula.mdSuwatchareeporn Rotcheewaphanchulamedj@chula.mdPornchai Kaewsapsakchulamedj@chula.md<p><em><strong><span class="fontstyle0">Background: </span></strong></em><span class="fontstyle2">Tuberculosis remains a major global health challenge, highlighting the need for new therapeutic targets. Mycobacteria can adapt to environmental stress and antibiotic exposure through a potential mechanism called epitranscriptomic regulation, mainly RNA methylation.</span></p> <p><em><strong><span class="fontstyle0">Objectives: </span></strong></em><span class="fontstyle2">This study investigates </span><span class="fontstyle3">msmeg_6073</span><span class="fontstyle2">, the </span><span class="fontstyle3">Mycobacterium smegmatis </span><span class="fontstyle2">ortholog of the essential </span><span class="fontstyle3">Mycobacterium tuberculosis </span><span class="fontstyle2">gene </span><span class="fontstyle3">rv3579c</span><span class="fontstyle2">, predicted to encode a 23S rRNA 22 -O-methyltransferase involved in ribosomal RNA modification.</span></p> <p><em><strong><span class="fontstyle0">Methods: </span></strong></em><span class="fontstyle2">Using an anhydrotetracycline (ATc)-inducible CRISPR interference (CRISPRi) system, knockdown strains targeting </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">were constructed. Among designed guide RNAs, guide 1 (5’ GGGAAGGCCGCGCCTGCGCACACCG 3’) showed the most consistent functional activity. RT-qPCR analysis confirmed transcriptional repression of </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">under 50 ng/mL ATc induction conditions. Expression analysis of the upstream gene </span><span class="fontstyle3">msmeg_6074 </span><span class="fontstyle2">(</span><span class="fontstyle3">cysS</span><span class="fontstyle2">) was also conducted to evaluate target specificity. Phenotypic analysis included ATc-inducible drop assays and liquid culture growth curve analysis.</span></p> <p><em><strong><span class="fontstyle0">Results: </span></strong></em><span class="fontstyle2">RT-qPCR analysis confirmed effective transcriptional repression of </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">under induced conditions. Furthermore, expression analysis of </span><span class="fontstyle3">msmeg_6074 </span><span class="fontstyle2">(</span><span class="fontstyle3">cysS</span><span class="fontstyle2">) showed no significant transcriptional changes, indicating targetspecific repression without upstream gene effects. Phenotypic analysis showed growth inhibition on solid media following </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">repression, whereas no significant growth defects were observed in liquid culture. These findings suggest that </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">repression may be condition dependent.</span></p> <p><em><strong><span class="fontstyle0">Conclusion: </span></strong></em><span class="fontstyle2">This study provides a validated CRISPRi workflow for inducible repression of </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">in </span><span class="fontstyle3">M. smegmatis</span><span class="fontstyle2">. Future RNA methylation and MIC analyses may help clarify the role of </span><span class="fontstyle3">msmeg_6073 </span><span class="fontstyle2">in ribosome-associated processes and susceptibility to ribosome-targeting antibiotics, improving understanding of the mycobacterial epitranscriptome and its potential relevance to future therapeutic strategies.</span> </p>2026-07-02T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/289859Functional characterization of the mraW RNA methyltransferase in growth and cell survival of Mycobacterium smegmatis2026-06-29T11:01:15+07:00Nitid Santikulchulamedj@chula.mdSuwatchareeporn Rotcheewaphanchulamedj@chula.mdPornchai Kaewsapsakchulamedj@chula.md<p><em><strong>Background:</strong> </em>Tuberculosis remains a major global health threat, exacerbated by the increasing prevalence of drugresistant strains. The RNA methyltransferase mraW is predicted to play an important regulator of bacterial gene expression and cellular physiology. However, its function in mycobacteria remains unclear.</p> <p><em><strong>Objective:</strong></em> This study aims to characterize the function of the mraW RNA methyltransferase in Mycobacterium smegmatis using a CRISPR interference (CRISPRi)-mediated gene knockdown.</p> <p><em><strong>Methods:</strong></em> A mraW-targeting sgRNA was constructed and expressed in M. smegmatis mc²155, and knockdown effect was induced using anhydrotetracycline (ATc). Knockdown efficiency was confirmed by RT-qPCR, which showed approximately 55% reduction in mraW transcript levels.</p> <p><em><strong>Results:</strong></em> Phenotypic analysis revealed that mraW knockdown resulted in ATc concentration-dependent growth inhibition, reduced colony formation, and decreased bacterial viability in both solid and liquid culture conditions. Consistent with the inducible nature of the CRISPRi system, stronger growth defects were observed at higher ATc concentrations, suggesting increased repression of mraW, while pLJR962 vector controls remained unaffected, confirming that the observed effects were specifically associated with mraW knockdown. These findings demonstrate that mraW is important for optimal growth and survival in M. smegmatis, supporting a role for RNA methyltransferases in essential mycobacterial physiological processes.</p> <p><em><strong>Conclusion:</strong></em> This study further highlights the utility of CRISPRi for functional characterization of essential genes in mycobacteria and suggests that RNA methylation pathways may represent novel potential targets for future anti-tuberculosis strategies.</p>2026-06-29T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/290007Dual Profiling of Fusicatenibacter saccharivorans and pks+ Escherichia coli as Stool Biomarkers for Colorectal Cancer Screening in a Thai Cohort2026-07-02T16:30:45+07:00Wissuta Yodboonruangchulamedj@chula.mdNutta Iadseechulamedj@chula.mdTeerasit Techawiwattanaboonchulamedj@chula.mdTanisa Patcharatrakulchulamedj@chula.mdSongphol Malakornchulamedj@chula.mdKanitha Patarakulchulamedj@chula.md<p><em><strong>Background:</strong></em> Fecal Immunochemical Test (FIT) is a standard non-invasive screening method for colorectal cancer (CRC) but exhibits limited sensitivity in detecting early-stage lesions, leading to delayed treatment. To improve early-stage CRC detection, it is essential to develop a non-invasive, widely applicable, and practical screening method that enhances the current FIT screening capabilities. Recent studies have shown that gut dysbiosis is associated with CRC development and therefore can serve as a source of fecal microbial biomarkers.</p> <p><em><strong>Objectives:</strong></em> To evaluate the stage-specific absolute and relative abundance profiles of candidate fecal microbial biomarkers along the colorectal adenoma-carcinoma sequence in a Thai cohort.</p> <p><em><strong>Methods:</strong></em> Stool samples were collected from three groups: healthy individuals, patients with high-risk adenomatous polyps, and early-stage CRC patients. Total DNA extraction and quantitative polymerase chain reaction (qPCR) were performed, followed by data analysis to identify fecal microbes that showed significant changes in patients with adenomatous polyps and colorectal cancer.</p> <p><em><strong>Results:</strong></em> Preliminary data revealed distinct, stage-specific quantitative alterations. The genotoxic pathobiont pks+ Escherichia coli demonstrated progressive enrichment, yielding a significant increase in the CRC group (P < 0.05). Conversely, the immunomodulatory symbiont Fusicatenibacter saccharivorans exhibited profound depletion upon malignant transformation (P < 0.01). Notably, pattern discrepancies between the absolute and relative abundance of F. saccharivorans underscored the impact of 16S rRNA gene copy number variations during background dysbiosis.</p> <p><em><strong>Conclusion:</strong></em> The dual profiling of these specific fecal microbial biomarkers, particularly through absolute quantification, suggests promising potential for enhancing non-invasive, early-stage CRC screening.</p>2026-07-02T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/289927Comparative efficacy of duo-gargling with sodium bicarbonate solution and Benzydamine hydrochloride (Difflam®) to single gargling with Benzydamine hydrochloride (Difflam®) in head and neck cancer participants who are receiving concurrent chemoradiotherapy2026-06-30T10:30:34+07:00Siraphob Sriprasertchulamedj@chula.md Anussara Prayongratchulamedj@chula.mdChanida Vinayanuwattikunchulamedj@chula.md<p><em><strong>Background:</strong> </em>Radiation-induced oral mucositis (RIOM) is a common complication of concurrent chemoradiotherapy (CCRT) in head and neck cancer (HNC). Benzydamine HCl is an established anti-inflammatory rinse for preventing RIOM, but it is not known whether adding sodium bicarbonate, which buffers oral pH and reduces microbial load, provides any added benefit.</p> <p><em><strong>Objective:</strong></em> To compare duo-gargling (Benzydamine HCl followed by sodium bicarbonate) with Benzydamine HCl alone for RIOM prevention in HNC patients receiving cisplatin-based CCRT.</p> <p><em><strong>Methods:</strong></em> In this preliminary analysis of a single-center, randomized, single-blinded trial, HNC patients receiving curativeintent CCRT were randomized 1:1 to duo-gargling or single gargling four times daily. The primary endpoint was the blindedassessed Oral Mucositis Assessment Scale (OMAS) score at week 7. Secondary endpoints included CTCAE v5.0 grading and supportive-care needs. Mixed-effects models were used for longitudinal analysis.</p> <p><em><strong>Results:</strong> </em>Twenty-one patients were analyzed (duo-gargling n = 10; single gargling n = 11) with balanced baseline characteristics. Mean week-7 OMAS score did not differ between groups (17.20 ± 4.89 vs. 18.55 ± 7.84; mean difference 1.35, 95% CI −4.19 to 6.88;P = 0.647), and there was no significant difference at any week. Grade ≥3 mucositis at week 7 was lower with duo-gargling (10.0% vs. 36.4%) but not significant. Opioid prescription at week 3 was significantly lower with duo-gargling (0.0% vs. 45.5%;P = 0.035).</p> <p><em><strong>Conclusion:</strong></em> In this preliminary analysis, adding sodium bicarbonate to Benzydamine HCl did not significantly reduce OMAS scores compared with Benzydamine HCl alone. Duo-gargling did show fewer severe mucositis events and lower early opioid use, but these findings need to be confirmed in the full study.</p>2026-06-30T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/289935Feasibility of generating allogeneic BCMA-directed CAR T cells using CD45RA depletion2026-06-30T13:13:06+07:00Arianwen Rollanchulamedj@chula.mdKoramit Suppipatchulamedj@chula.mdSupannikar Tawinwungchulamedj@chula.mdNattiya Hirankarnchulamedj@chula.md<p><em><strong>Backgrounds:</strong></em> Chimeric antigen receptor (CAR) T cell therapy has recently exhibited promise as cancer treatment, especially for hematologic malignancies. Currently, all of the FDA-approved CAR T therapies are autologous in nature. This presents as a limitation since generating CAR T cell using the patient’s own blood leads to higher costs and a 3–4 week production time. To overcome this, allogeneic CAR T cell-therapy is being explored.</p> <p><em><strong>Objective:</strong></em> In this study, CD45RA depletion was used to generate allogeneic anti-BCMA CAR TT cells. This approach aims to utilize the CD45RA-negative fraction containing memory T cells which has lower alloreactivity and reduced risk to cause graft-versus-host disease (GVHD).</p> <p><em><strong>Methods:</strong> </em>The CD45RA-negative T cells were obtained through magnetic separation of CD45RA-labeled PBMCs. This process yielded the flow-through containing the unlabeled CD45RA-negative fraction which was then used to produce CAR T cells through lentiviral transduction. The generated CD45RA-negative anti-BCMA CAR T cells were compared to nondepleted anti-BCMA CAR T cells according to transduction efficiency, cell expansion, memory phenotype and cell subset. Cytotoxic function was also assessed through co-culture assays.</p> <p><em><strong>Results:</strong></em> Results show higher transduction efficiency and MFI of CD45RA-negative CAR T cells on days 4 and 11, respectively with no difference in expansion. They also feature more CD4+ cell subset and Tem memory phenotype. Results show no statistically significant difference between non-depleted and depleted anti-BCMA CAR T cells in in vitro co-culture assay.</p> <p><em><strong>Conclusion:</strong> </em>The data demonstrate CD45RA depletion as a feasible approach to generating allogeneic anti-BCMA CAR T cells</p>2026-06-30T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/289944Field-deployable genetic methods for subspecies identification of long-tailed macaques (Macaca fascicularis) based on Oxford Nanopore technologies2026-06-30T15:42:07+07:00Juthamas Nimnualchulamedj@chula.mdVorthon Sawaswongchulamedj@chula.mdSuthida Visedthornchulamedj@chula.mdAriya Khamwutchulamedj@chula.mdTaratorn Kemthongchulamedj@chula.mdSuchinda Malaivijitnondchulamedj@chula.mdSunchai Payungpornchulamedj@chula.md<p><em><strong>Background:</strong> </em>Long-tailed macaque (Macaca fascicularis) is an ecologically and biomedically important primate widely distributed throughout Southeast Asia. Accurate subspecies identification is essential for conservation, ecological monitoring, and biomedical research. Morphological classification is often unreliable in hybrids.</p> <p><em><strong>Objective:</strong></em> To develop and evaluate a field-deployable genetic workflow for subspecies identification of M. fascicularis using fecal swab samples and Oxford Nanopore Technologies (ONT).</p> <p><em><strong>Methods:</strong></em> Fecal swab samples were collected from 30 individuals representing M. fascicularis fascicularis (n = 10), M. fascicularis aurea (n = 10), and hybrids (Mff×Mfa; n = 10). DNA from NAPSeq-preserved swabs was PCR-amplified for the mitochondrial hypervariable segment I (HVSI) and the sex-determining region Y (SRY) gene, followed by ONT sequencing and phylogenetic analysis.</p> <p><em><strong>Results:</strong> </em>All samples yielded adequate DNA concentration (37.6 ± 17.7 ng/µL) and purity (A260/A280 = 1.90 ± 0.12). HVSI (881 bp) and SRY (846 bp) target genes were successfully amplified. ONT sequencing produced 560,171 raw reads (HVSI) and 220,740 raw reads (SRY). Phylogenetic analysis based on HVSI and SRY determined maternal and paternal lineages, respectively, enabling identification of subspecies and hybrid ancestry. Subspecies classification was concordant between morphology-based and ONT-based analyses for all samples, demonstrating the reliability and accuracy of the genetic workflow.</p> <p><em><strong>Conclusion:</strong></em> ONT-based sequencing of DNA extracted from fecal samples provides a practical and reliable approach for field-deployable subspecies identification in M. fascicularis, which would be applicable for ecological surveillance and quality control of non-human primate models in biomedical research.</p>2026-06-30T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/289967Curcumin supplementation lowers serum IL-1β and IL-6 levels and increases physical functions in knee osteoarthritis patients2026-07-01T13:06:24+07:00Kongpob Wanikanukulchulamedj@chula.mdSitthinee Leenachulamedj@chula.mdSuphattra Phakhamchulamedj@chula.mdSuvichada Assawakosrichulamedj@chula.mdSittisak Honsawekchulamedj@chula.md<p><em><strong>Background:</strong></em> Knee osteoarthritis (KOA) is a degenerative joint disease driven by low-grade chronic inflammation. Longterm dependence on non-steroidal anti-inflammatory drugs (NSAIDs) is constrained by serious systemic risks, highlighting the clinical need for safe, bioavailable adjuvant therapies such as curcumin phytosome.</p> <p><em><strong>Objectives:</strong></em> This study aimed to evaluate the efficacy of daily curcumin phytosome supplementation versus placebo in primary KOA, with oral naproxen restricted to as-needed (PRN) rescue analgesia.</p> <p><em><strong>Methods:</strong> </em>In this 4-week randomized, single-blind, parallel-group trial, 74 patients with primary KOA (Kellgren–Lawrence grades 1–2) received either curcumin phytosome (250 mg twice daily; n = 52) or matching placebo (n = 22). Oral naproxen (250 mg) was permitted only as rescue medication. Serum interleukin (IL)-1β and IL-6 levels, the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), Visual Analogue Scale (VAS), and physical performance tests, including the 3-minute walk test (3-MWT), gait speed test (GST), chair stand test (CST), and timed up and go (TUG) test, were assessed at baseline and week 4. Changes from baseline (Δ) were compared between groups using the Mann– Whitney U test.</p> <p><em><strong>Results:</strong></em> Compared with the placebo group, curcumin supplementation demonstrated significantly greater reductions in serum IL-1β (P = 0.001) and IL-6 (P = 0.0282). Significant improvements were also observed in WOMAC pain (P = 0.0038), stiffness (P = 0.0043), physical function (P <0.0001), total WOMAC score (P <0.0001), VAS pain score (P <0 .05), GST (P = 0.039), and TUG (P = 0.0174). There were no significant differences in the 3-MWT and CST between placebo group and curcumin group.</p> <p><em><strong>Conclusions:</strong></em> Daily curcumin supplementation resulted in greater reductions in serum IL-1β and IL-6 as well as greater improvements in pain, physical function, and selected mobility outcomes, compared with placebo in primary KOA patients.</p>2026-07-01T00:00:00+07:00Copyright (c) 2026 Journal of Medical Biosciencehttps://he01.tci-thaijo.org/index.php/clmb/article/view/290003Optimization and performance evaluation of PCR primers for human respiratory viruses detection2026-07-02T16:08:29+07:00Kittima Phutthawongchulamedj@chula.mdAriya Khamwutchulamedj@chula.mdSasiprapa Anomachulamedj@chula.md<p><em><strong>Background:</strong></em> Respiratory viral infections are a main cause of acute respiratory disease and contribute to morbidity worldwide. The wide diversity of viruses presents challenges for comprehensive detection.</p> <p><em><strong>Objectives:</strong></em> To develop, optimize, and evaluate polymerase chain reaction (PCR) primers targeting genomic regions of human respiratory viruses, including Adenovirus, Bocavirus, Parvovirus B19, Influenza virus, Respiratory syncytial virus, Metapneumovirus, Rhinovirus, Enterovirus A71, Coxsackievirus A16, Parainfluenza virus, Measles virus, Mumps virus, and Coronaviruses.</p> <p><em><strong>Methods:</strong></em> Genome reference sequences (2019–2025) were obtained from NCBI and BV-BRC databases. Nucleotide sequences were aligned using MEGA X to identify conserved regions for each virus and designed as primers with degenerate bases to support sequence variation based on standard parameters, which consist of melting temperature (55℃–65℃), GC content (35%–60%), amplicon length (380–700 bp), and predicted secondary structure using the OligoAnalyzer™ and Oligos. Primer specificity was assessed using sequence alignment and similarity searches using the NCBI BLAST to minimize off-target sequences. Then, gradient PCR was performed to optimize the annealing temperature, and the limit of detection was evaluated using a 10-fold serial dilution of the standard plasmid containing the specific gene of each virus.</p> <p><em><strong>Results:</strong></em> This study demonstrated that 16 primer pairs with suitable thermodynamic properties exhibited minimal secondary structures. Preliminary results showed that all primers successfully produced PCR products of the expected amplicon size, without cross-amplification with human cDNA samples. The limit of detection ranged from 102 to 105 copies/µL.</p> <p><em><strong>Conclusion:</strong></em> These findings provide a preliminary result of suitable candidate primers for human respiratory viral detection.</p>2026-07-02T00:00:00+07:00Copyright (c) 2026 Journal of Medical Bioscience